Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xylH gene

Properties
Regulog: XylR - Clostridia-1
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Firmicutes
Built upon 20 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium beijerincki NCIMB 8052
Position: -78
Score: 5.92116
Sequence: CATTATTAAAGGACATTTTAAAAGT
Locus tag: Cbei_2377
Name: xylF1
Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component
Locus tag: Cbei_2378
Name: Cbei_2378
Funciton: Two-component sensor histidine kinase
Locus tag: Cbei_2379
Name: Cbei_2379
Funciton: Two-component response regulator yesN
Locus tag: Cbei_2380
Name: xylF
Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF
Locus tag: Cbei_2381
Name: xylG
Funciton: D-xylose transport ATP-binding protein XylG
Locus tag: Cbei_2382
Name: xylH
Funciton: Xylose ABC transporter, permease protein XylH
xylF1-Cbei_2378-Cbei_2379-xylF-xylG-xylH -78 5.9 CATTATTAAAGGACATTTTAAAAGT Cbei_2377