Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mlnR gene

Properties
Regulog: MlnR - Alcaligenaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Malonate metabolism
Effector:
Phylum: Proteobacteria/Beta
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bordetella bronchiseptica RB50
Position: -37
Score: 6.65499
Sequence: TTATTCATAATTATGAATTA
Locus tag: BB3362
Name: mlnR
Funciton: Transcriptional regulator of malonate metabolism, GntR family
Locus tag: BB3361
Name: matA
Funciton: Malonyl-CoA decarboxylase
Locus tag: BB3360
Name: BB3360
Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
Locus tag: BB3359
Name: matB
Funciton: Malonyl CoA synthetase
Locus tag: BB3358
Name: null
Funciton: putative exported protein
Locus tag: BB3357
Name: sodC
Funciton: Superoxide dismutase [Cu-Zn] precursor (EC 1.15.1.1)
Locus tag: BB3356
Name: BAV2471
Funciton: ABC transporter substrate-binding protein
Locus tag: BB3355
Name: BAV2470
Funciton: ABC transporter, permease protein
Locus tag: BB3354
Name: BAV2469
Funciton: ABC transporter, ATP-binding protein
mlnR-matA-BB3360-matB-BB3358-sodC-BAV2471-BAV2470-BAV2469 -37 6.7 TTATTCATAATTATGAATTA BB3362
Bordetella petrii DSM 12804
Position: -43
Score: 5.4133
Sequence: TTTCCTATAATTATGAATTA
Locus tag: Bpet3277
Name: mlnR
Funciton: Transcriptional regulator of malonate metabolism, GntR family
Locus tag: Bpet3276
Name: matA
Funciton: Malonyl-CoA decarboxylase
Locus tag: Bpet3275
Name: BB3360
Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
Locus tag: Bpet3274
Name: matB
Funciton: Malonyl CoA synthetase
Locus tag: Bpet3273
Name: matP
Funciton: TRAP-type malonate transport system, periplasmic component
Locus tag: Bpet3272
Name: matM
Funciton: TRAP-type malonate transport system, small permease component
Locus tag: Bpet3271
Name: matQ
Funciton: TRAP-type malonate transport system, large permease component
Locus tag: Bpet3270
Name: BAV2471
Funciton: ABC transporter substrate-binding protein
Locus tag: Bpet3269
Name: BAV2470
Funciton: ABC transporter, permease protein
Locus tag: Bpet3268
Name: BAV2469
Funciton: ABC transporter, ATP-binding protein
mlnR-matA-BB3360-matB-matP-matM-matQ-BAV2471-BAV2470-BAV2469 -43 5.4 TTTCCTATAATTATGAATTA Bpet3277