Orthologous regulated operons containing BAV2471 gene

Properties
Regulog:	MlnR - Alcaligenaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Phylum:	Proteobacteria/Beta

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bordetella bronchiseptica RB50
Position: -37 Score: 6.65499 Sequence: TTATTCATAATTATGAATTA Locus tag: BB3362 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: BB3361 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: BB3360 Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase Locus tag: BB3359 Name: matB Funciton: Malonyl CoA synthetase Locus tag: BB3358 Name: null Funciton: putative exported protein Locus tag: BB3357 Name: sodC Funciton: Superoxide dismutase [Cu-Zn] precursor (EC 1.15.1.1) Locus tag: BB3356 Name: BAV2471 Funciton: ABC transporter substrate-binding protein Locus tag: BB3355 Name: BAV2470 Funciton: ABC transporter, permease protein Locus tag: BB3354 Name: BAV2469 Funciton: ABC transporter, ATP-binding protein
mlnR-matA-BB3360-matB-BB3358-sodC-BAV2471-BAV2470-BAV2469	-37	6.7	TTATTCATAATTATGAATTA	BB3362
Bordetella petrii DSM 12804
Position: -43 Score: 5.4133 Sequence: TTTCCTATAATTATGAATTA Locus tag: Bpet3277 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: Bpet3276 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: Bpet3275 Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase Locus tag: Bpet3274 Name: matB Funciton: Malonyl CoA synthetase Locus tag: Bpet3273 Name: matP Funciton: TRAP-type malonate transport system, periplasmic component Locus tag: Bpet3272 Name: matM Funciton: TRAP-type malonate transport system, small permease component Locus tag: Bpet3271 Name: matQ Funciton: TRAP-type malonate transport system, large permease component Locus tag: Bpet3270 Name: BAV2471 Funciton: ABC transporter substrate-binding protein Locus tag: Bpet3269 Name: BAV2470 Funciton: ABC transporter, permease protein Locus tag: Bpet3268 Name: BAV2469 Funciton: ABC transporter, ATP-binding protein
mlnR-matA-BB3360-matB-matP-matM-matQ-BAV2471-BAV2470-BAV2469	-43	5.4	TTTCCTATAATTATGAATTA	Bpet3277