Orthologous regulated operons containing psiK gene

Properties
Regulog:	PsiR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Psicose utilization
Effector:	Psicose
Phylum:	Proteobacteria/Alpha

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium sp. NGR234
Position: -173 Score: 6.64981 Sequence: TTGCACCATCGATTGTGCAA Position: -151 Score: 5.18165 Sequence: AAGAAATATCGATTGTGCAG Locus tag: NGR_b11530 Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein Locus tag: NGR_b11540 Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein Locus tag: NGR_b11550 Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: NGR_b11560 Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: NGR_b11570 Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-) Locus tag: NGR_b11580 Name: psiK Funciton: Predicted fructokinase, FGGY family Locus tag: NGR_b11590 Name: fucA Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
psiA-psiB-psiC-psiD-psiE-psiK-fucA	-173	6.6	TTGCACCATCGATTGTGCAA	NGR_b11530
	-151	5.2	AAGAAATATCGATTGTGCAG
Sinorhizobium meliloti 1021
Position: -173 Score: 6.64981 Sequence: TTGCACCATCGATTGTGCAA Position: -151 Score: 5.42948 Sequence: AAGAAATATCGATTGTGCAA Locus tag: SMb20484 Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein Locus tag: SMb20485 Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein Locus tag: SMb20486 Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: SMb20487 Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: SMb20488 Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-) Locus tag: SMb20489 Name: psiK Funciton: Predicted fructokinase, FGGY family Locus tag: SMb20490 Name: fucA2 Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
psiA-psiB-psiC-psiD-psiE-psiK-fucA2	-173	6.6	TTGCACCATCGATTGTGCAA	SMb20484
	-151	5.4	AAGAAATATCGATTGTGCAA