Orthologous regulated operons containing tpfX gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -199
Score: 5.40986 Sequence: TTTTGAAATGATGTTTCATAT
Locus tag: CKO_01049
Name: tpfX Funciton: ThiJ/PfpI-family hypothetical protein |
||||
| tpfX | -199 | 5.4 | TTTTGAAATGATGTTTCATAT | CKO_01049 |
| Enterobacter sp. 638 | ||||
|
Position: -42
Score: 5.0274 Sequence: GGATGAAACGCTGTTTTAAAT
Locus tag: Ent638_2477
Name: tpfX Funciton: ThiJ/PfpI-family hypothetical protein |
||||
| tpfX | -42 | 5 | GGATGAAACGCTGTTTTAAAT | Ent638_2477 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -85
Score: 6.13996 Sequence: TAATAAAACATCGTTTCATTT
Locus tag: ECA0102
Name: tpfX Funciton: ThiJ/PfpI-family hypothetical protein |
||||
| tpfX | -85 | 6.1 | TAATAAAACATCGTTTCATTT | ECA0102 |
| Salmonella typhimurium LT2 | ||||
|
Position: -231
Score: 5.35913 Sequence: TTATGAAACATTGTTTCAGAT
Locus tag: STM1931
Name: tpfX Funciton: ThiJ/PfpI-family hypothetical protein |
||||
| tpfX | -231 | 5.4 | TTATGAAACATTGTTTCAGAT | STM1931 |