Orthologous regulated operons containing uraA gene
| Regulog: | RutR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas stutzeri A1501 | ||||
|
Position: -159
Score: 5.25418 Sequence: ACCTGACCGAACAGACTACT
Locus tag: PST_3175
Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Locus tag: PST_3176
Name: uraA Funciton: Uracil permease |
||||
| upp-uraA | -159 | 5.3 | ACCTGACCGAACAGACTACT | PST_3175 |