Orthologous regulated operons containing pbuT2 gene
| Regulog: | RutR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas mendocina ymp | ||||
|
Position: -100
Score: 5.49641 Sequence: TTCTGACCGACCAGACAGCT
Locus tag: Pmen_2762
Name: pbuT2 Funciton: Xanthine/uracil permease
Locus tag: Pmen_2763
Name: tsx Funciton: Nucleoside-binding outer membrane protein |
||||
| pbuT2-tsx | -100 | 5.5 | TTCTGACCGACCAGACAGCT | Pmen_2762 |