Orthologous regulated operons containing pbuT4 gene
| Regulog: | RutR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas mendocina ymp | ||||
|
Position: -36
Score: 5.57314 Sequence: GCCTGACCAATCGGACAACA
Locus tag: Pmen_4444
Name: pbuT4 Funciton: Xanthine/uracil permease |
||||
| pbuT4 | -36 | 5.6 | GCCTGACCAATCGGACAACA | Pmen_4444 |