Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pbuT4 gene

Properties
Regulog: RutR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas mendocina ymp
Position: -36
Score: 5.57314
Sequence: GCCTGACCAATCGGACAACA
Locus tag: Pmen_4444
Name: pbuT4
Funciton: Xanthine/uracil permease
pbuT4 -36 5.6 GCCTGACCAATCGGACAACA Pmen_4444