Orthologous regulated operons containing ppuC gene
| Regulog: | RutR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -65
Score: 5.37429 Sequence: TCCTGACCTCCTGGCCAGGT
Locus tag: PA0136
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: PA0137
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: PA0138
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor |
||||
| ppuA-ppuC-ppuD | -65 | 5.4 | TCCTGACCTCCTGGCCAGGT | PA0136 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -22
Score: 5.38842 Sequence: TCCTGACCCACTGGCCAGGA
Locus tag: PFL_0728
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: PFL_0727
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: PFL_0726
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor |
||||
| ppuA-ppuC-ppuD | -22 | 5.4 | TCCTGACCCACTGGCCAGGA | PFL_0728 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -64
Score: 5.60056 Sequence: ACCTGACCCATTGGCCAGGA
Locus tag: PSPTO0769
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: PSPTO0768
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: PSPTO0767
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor |
||||
| ppuA-ppuC-ppuD | -64 | 5.6 | ACCTGACCCATTGGCCAGGA | PSPTO0769 |