Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tsx2 gene

Properties
Regulog: RutR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas entomophila L48
Position: -179
Score: 6.02948
Sequence: AACTGACCAATCGGGCAAGT
Locus tag: PSEEN1685
Name: COG0726
Funciton: putative polysaccharide deacetylase family protein
Locus tag: PSEEN1684
Name: pucL
Funciton: Uricase (EC 1.7.3.3)
Locus tag: PSEEN1683
Name: allA
Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: PSEEN1682
Name: COG3748
Funciton: hypothetical protein, COG3748
Locus tag: PSEEN1681
Name: pbuT2
Funciton: Xanthine/uracil permease
Locus tag: PSEEN1680
Name: tsx2
Funciton: Nucleoside-binding outer membrane protein
COG0726-pucL-allA-COG3748-pbuT2-tsx2 -179 6 AACTGACCAATCGGGCAAGT PSEEN1685
Pseudomonas putida KT2440
Position: -189
Score: 5.97513
Sequence: AGCTGACCAAACAGGCAGGT
Locus tag: PP4286
Name: COG0726
Funciton: putative polysaccharide deacetylase family protein
Locus tag: PP4287
Name: pucL
Funciton: Uricase (EC 1.7.3.3)
Locus tag: PP4288
Name: allA
Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: PP4289
Name: COG3748
Funciton: hypothetical protein, COG3748
Locus tag: PP4290
Name: pbuT2
Funciton: Xanthine/uracil permease
Locus tag: PP4291
Name: tsx2
Funciton: Nucleoside-binding outer membrane protein
COG0726-pucL-allA-COG3748-pbuT2-tsx2 -189 6 AGCTGACCAAACAGGCAGGT PP4286
© 2009-2020 RegPrecise