Orthologous regulated operons containing pbuT2 gene
| Regulog: | RutR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas entomophila L48 | ||||
|
Position: -179
Score: 6.02948 Sequence: AACTGACCAATCGGGCAAGT
Locus tag: PSEEN1685
Name: COG0726 Funciton: putative polysaccharide deacetylase family protein
Locus tag: PSEEN1684
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: PSEEN1683
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: PSEEN1682
Name: COG3748 Funciton: hypothetical protein, COG3748
Locus tag: PSEEN1681
Name: pbuT2 Funciton: Xanthine/uracil permease
Locus tag: PSEEN1680
Name: tsx2 Funciton: Nucleoside-binding outer membrane protein |
||||
| COG0726-pucL-allA-COG3748-pbuT2-tsx2 | -179 | 6 | AACTGACCAATCGGGCAAGT | PSEEN1685 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -189
Score: 5.65122 Sequence: AGCTGACCATCCAGGCAAGT
Locus tag: PFL_4366
Name: COG0726 Funciton: putative polysaccharide deacetylase family protein
Locus tag: PFL_4367
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: PFL_4368
Name: allC Funciton: Allantoicase (EC 3.5.3.4)
Locus tag: PFL_4369
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: PFL_4370
Name: COG3748 Funciton: hypothetical protein, COG3748
Locus tag: PFL_4371
Name: pbuT2 Funciton: Xanthine/uracil permease |
||||
| COG0726-pucL-allC-allA-COG3748-pbuT2 | -189 | 5.7 | AGCTGACCATCCAGGCAAGT | PFL_4366 |
| Pseudomonas putida KT2440 | ||||
|
Position: -189
Score: 5.97513 Sequence: AGCTGACCAAACAGGCAGGT
Locus tag: PP4286
Name: COG0726 Funciton: putative polysaccharide deacetylase family protein
Locus tag: PP4287
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: PP4288
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: PP4289
Name: COG3748 Funciton: hypothetical protein, COG3748
Locus tag: PP4290
Name: pbuT2 Funciton: Xanthine/uracil permease
Locus tag: PP4291
Name: tsx2 Funciton: Nucleoside-binding outer membrane protein |
||||
| COG0726-pucL-allA-COG3748-pbuT2-tsx2 | -189 | 6 | AGCTGACCAAACAGGCAGGT | PP4286 |