Orthologous regulated operons containing omp2 gene
| Regulog: | RutR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonas macleodii 'Deep ecotype' | ||||
|
Position: -124
Score: 5.22752 Sequence: AGTTGACCAACTGGTTAAGT
Locus tag: MADE_02502
Name: omp2 Funciton: putative TonB-dependent outer membrane transporter |
||||
| omp2 | -124 | 5.2 | AGTTGACCAACTGGTTAAGT | MADE_02502 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -112
Score: 5.73278 Sequence: ACCTGACCATTTGGACAAGT
Locus tag: Patl_2225
Name: omp2 Funciton: putative TonB-dependent outer membrane transporter |
||||
| omp2 | -112 | 5.7 | ACCTGACCATTTGGACAAGT | Patl_2225 |