Orthologous regulated operons containing allC gene
Regulog: | RutR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Colwellia psychrerythraea 34H | ||||
Position: -94
Score: 3.51291 Sequence: AGCTGACACTTGTGTCAACT
Locus tag: CPS_4864
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: CPS_4865
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: CPS_4866
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: CPS_4867
Name: allB Funciton: Allantoinase (EC 3.5.2.5)
Locus tag: CPS_4868
Name: allC Funciton: Allantoicase (EC 3.5.3.4)
Locus tag: CPS_4869
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: CPS_4870
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: CPS_4871
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: CPS_4872
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) |
||||
xdhA-xdhB-xdhC-allB-allC-pucL-pucM-allA-guaD | -94 | 3.5 | AGCTGACACTTGTGTCAACT | CPS_4864 |