Orthologous regulated operons containing COG0726 gene
| Regulog: | RutR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -328
Score: 5.08432 Sequence: ACATATCCTTTTGGTCAGGT
Position: -148
Score: 4.9395 Sequence: AGTTAACCGATCGGTCAGGC
Locus tag: ATW7_02017
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: ATW7_02012
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: ATW7_02007
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: ATW7_02002
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: ATW7_01997
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: ATW7_01992
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
Locus tag: ATW7_01987
Name: COG3748 Funciton: hypothetical protein, COG3748
Locus tag: ATW7_01982
Name: COG0726 Funciton: putative polysaccharide deacetylase family protein |
||||
| xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748-COG0726 | -328 | 5.1 | ACATATCCTTTTGGTCAGGT | ATW7_02017 |
| -148 | 4.9 | AGTTAACCGATCGGTCAGGC | ||
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -242
Score: 5.87522 Sequence: ACCAGACCAGTTGGTCAGGT
Locus tag: Patl_2423
Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Locus tag: Patl_2422
Name: COG0726 Funciton: putative polysaccharide deacetylase family protein |
||||
| rutR-COG0726 | -242 | 5.9 | ACCAGACCAGTTGGTCAGGT | Patl_2423 |