Orthologous regulated operons containing pbuT2 gene
| Regulog: | RutR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonas macleodii 'Deep ecotype' | ||||
|
Position: -353
Score: 5.48481 Sequence: AACAGACCAGTTGGTCAACA
Locus tag: MADE_02501
Name: pbuT2 Funciton: Xanthine/uracil permease |
||||
| pbuT2 | -353 | 5.5 | AACAGACCAGTTGGTCAACA | MADE_02501 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -27
Score: 5.51419 Sequence: GACTGACCATTTGGTCAAAT
Locus tag: Patl_2222
Name: add2 Funciton: Adenosine deaminase (EC 3.5.4.4)
Locus tag: Patl_2223
Name: pbuT2 Funciton: Xanthine/uracil permease |
||||
| add2-pbuT2 | -27 | 5.5 | GACTGACCATTTGGTCAAAT | Patl_2222 |