Orthologous regulated operons containing add2 gene
Regulog: | RutR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudoalteromonas atlantica T6c | ||||
Position: -27
Score: 5.51419 Sequence: GACTGACCATTTGGTCAAAT
Locus tag: Patl_2222
Name: add2 Funciton: Adenosine deaminase (EC 3.5.4.4)
Locus tag: Patl_2223
Name: pbuT2 Funciton: Xanthine/uracil permease |
||||
add2-pbuT2 | -27 | 5.5 | GACTGACCATTTGGTCAAAT | Patl_2222 |