Orthologous regulated operons containing tsx gene
| Regulog: | RutR3 - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas entomophila L48 | ||||
|
Position: -71
Score: 4.70981 Sequence: AGCTGACCCAAAAGACAAGA
Locus tag: PSEEN1679
Name: tsx Funciton: Nucleoside-binding outer membrane protein |
||||
| tsx | -71 | 4.7 | AGCTGACCCAAAAGACAAGA | PSEEN1679 |
| Pseudomonas putida KT2440 | ||||
|
Position: -74
Score: 4.80247 Sequence: AGCTGACTCAAAAGACAAAA
Locus tag: PP4293
Name: tsx Funciton: Nucleoside-binding outer membrane protein |
||||
| tsx | -74 | 4.8 | AGCTGACTCAAAAGACAAAA | PP4293 |