Orthologous regulated operons containing xdhA gene
| Regulog: | RutR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -201
Score: 4.84897 Sequence: ACCTGACTGCACGGACAAAA
Position: -77
Score: 4.16204 Sequence: AATTGTCTATTTGGCCAGTC
Locus tag: CJA_0546
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: CJA_0547
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: CJA_0548
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: CJA_0549
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: CJA_0550
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: CJA_0551
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
Locus tag: CJA_0552
Name: COG3748 Funciton: Predicted inner membrane protein |
||||
| xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748 | -201 | 4.8 | ACCTGACTGCACGGACAAAA | CJA_0546 |
| -77 | 4.2 | AATTGTCTATTTGGCCAGTC | ||
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -75
Score: 4.98954 Sequence: AGTTGACCAGATGGTCATAC
Locus tag: Csal_1789
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: Csal_1788
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: Csal_1787
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
||||
| xdhA-xdhB-xdhC | -75 | 5 | AGTTGACCAGATGGTCATAC | Csal_1789 |
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -157
Score: 5.22625 Sequence: ACCTGACCATGTAGACAAGT
Locus tag: HCH_01099
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: HCH_01098
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: HCH_01097
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: HCH_01096
Name: allB Funciton: Allantoinase (EC 3.5.2.5)
Locus tag: HCH_01095
Name: allC Funciton: Allantoicase (EC 3.5.3.4)
Locus tag: HCH_01094
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: HCH_01093
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: HCH_01092
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: HCH_01091
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
Locus tag: HCH_01090
Name: COG3748 Funciton: Predicted inner membrane protein |
||||
| xdhA-xdhB-xdhC-allB-allC-pucL-pucM-allA-guaD-COG3748 | -157 | 5.2 | ACCTGACCATGTAGACAAGT | HCH_01099 |
| Marinobacter sp. ELB17 | ||||
|
Position: -196
Score: 5.22433 Sequence: ACTAGACTATTTGGTCAGGT
Locus tag: MELB17_16808
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: MELB17_16813
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: MELB17_16818
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
||||
| xdhA-xdhB-xdhC | -196 | 5.2 | ACTAGACTATTTGGTCAGGT | MELB17_16808 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -83
Score: 4.96178 Sequence: ATTTGTACGATTGGTCAGGT
Locus tag: Mmwyl1_2699
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: Mmwyl1_2698
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: Mmwyl1_2697
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
||||
| xdhA-xdhB-xdhC | -83 | 5 | ATTTGTACGATTGGTCAGGT | Mmwyl1_2699 |
| Oceanobacter sp. RED65 | ||||
|
Position: -230
Score: 5.42876 Sequence: AACTGACCATATGGACAGAA
Position: -125
Score: 5.70112 Sequence: AGCTGACTAATTGGTCAGAT
Locus tag: RED65_04290
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: RED65_04295
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: RED65_04300
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: RED65_04305
Name: allC Funciton: Allantoicase (EC 3.5.3.4)
Locus tag: RED65_04310
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: RED65_04315
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: RED65_04320
Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19)
Locus tag: RED65_04325
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
Locus tag: RED65_04330
Name: COG3748 Funciton: Predicted inner membrane protein |
||||
| xdhA-xdhB-xdhC-allC-pucL-pucM-allA-guaD-COG3748 | -230 | 5.4 | AACTGACCATATGGACAGAA | RED65_04290 |
| -125 | 5.7 | AGCTGACTAATTGGTCAGAT | ||
| Reinekea sp. MED297 | ||||
|
Position: -147
Score: 5.86323 Sequence: ACCTGACCGCATGGTCAGCT
Locus tag: MED297_08316
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: MED297_08321
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: MED297_08326
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: MED297_08331
Name: allB Funciton: Allantoinase (EC 3.5.2.5)
Locus tag: MED297_08336
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: MED297_08341
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: MED297_08346
Name: COG3748 Funciton: Predicted inner membrane protein |
||||
| xdhA-xdhB-xdhC-allB-pucL-pucM-COG3748 | -147 | 5.9 | ACCTGACCGCATGGTCAGCT | MED297_08316 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -252
Score: 4.66985 Sequence: ATTTGACCACTAGGACAAAT
Position: -89
Score: 5.64764 Sequence: ACCTGACCGAATGGCCAGCT
Locus tag: TERTU_2067
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: TERTU_2066
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: TERTU_2065
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: TERTU_2064
Name: pucL Funciton: Uricase (EC 1.7.3.3)
Locus tag: TERTU_2063
Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17)
Locus tag: TERTU_2062
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
Locus tag: TERTU_2061
Name: COG3748 Funciton: Predicted inner membrane protein |
||||
| xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748 | -252 | 4.7 | ATTTGACCACTAGGACAAAT | TERTU_2067 |
| -89 | 5.6 | ACCTGACCGAATGGCCAGCT | ||