Orthologous regulated operons containing hpt gene
| Regulog: | RutR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Teredinibacter turnerae T7901 | ||||
|
Position: -96
Score: 5.79743 Sequence: TTCTGACCAAATGGTCAGCT
Locus tag: TERTU_2072
Name: hpt Funciton: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
Locus tag: TERTU_2071
Name: nupP Funciton: Predicted purine nucleoside permease |
||||
| hpt-nupP | -96 | 5.8 | TTCTGACCAAATGGTCAGCT | TERTU_2072 |