Orthologous regulated operons containing ppuB gene
| Regulog: | RutR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -165
Score: 4.51594 Sequence: GACTGGCCAAATAGACAATT
Position: -41
Score: 4.42269 Sequence: TTTTGTCCGTGCAGTCAGGT
Locus tag: CJA_0545
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: CJA_0544
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: CJA_0543
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
Locus tag: CJA_0542
Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor
Locus tag: CJA_0541
Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Locus tag: CJA_0540
Name: ssnA Funciton: Predicted chlorohydrolase/aminohydrolase |
||||
| ppuA-ppuC-ppuD-ppuB-rutR-ssnA | -165 | 4.5 | GACTGGCCAAATAGACAATT | CJA_0545 |
| -41 | 4.4 | TTTTGTCCGTGCAGTCAGGT | ||
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -106
Score: 5.03421 Sequence: ACCTGTCCGGCTGGTCATAA
Locus tag: HCH_01504
Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor
Locus tag: HCH_01503
Name: add Funciton: Adenosine deaminase (EC 3.5.4.4) |
||||
| ppuB-add | -106 | 5 | ACCTGTCCGGCTGGTCATAA | HCH_01504 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -185
Score: 4.46966 Sequence: TATTAACTAGTCGGTCAGAT
Locus tag: Mmwyl1_1926
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: Mmwyl1_1925
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: Mmwyl1_1924
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
Locus tag: Mmwyl1_1923
Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor
Locus tag: Mmwyl1_1922
Name: add Funciton: Adenosine deaminase (EC 3.5.4.4) |
||||
| ppuA-ppuC-ppuD-ppuB-add | -185 | 4.5 | TATTAACTAGTCGGTCAGAT | Mmwyl1_1926 |