Orthologous regulated operons containing ppuA gene

Properties
Regulog:	RutR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma

Built upon 32 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -165 Score: 4.51594 Sequence: GACTGGCCAAATAGACAATT Position: -41 Score: 4.42269 Sequence: TTTTGTCCGTGCAGTCAGGT Locus tag: CJA_0545 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: CJA_0544 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: CJA_0543 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: CJA_0542 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: CJA_0541 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: CJA_0540 Name: ssnA Funciton: Predicted chlorohydrolase/aminohydrolase
ppuA-ppuC-ppuD-ppuB-rutR-ssnA	-165	4.5	GACTGGCCAAATAGACAATT	CJA_0545
	-41	4.4	TTTTGTCCGTGCAGTCAGGT
Hahella chejuensis KCTC 2396
Position: -111 Score: 5.10681 Sequence: TCTTGACTACTTGGTCAGAA Locus tag: HCH_02310 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: HCH_02311 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: HCH_02312 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
ppuA-ppuC-ppuD	-111	5.1	TCTTGACTACTTGGTCAGAA	HCH_02310
Marinomonas sp. MWYL1
Position: -185 Score: 4.46966 Sequence: TATTAACTAGTCGGTCAGAT Locus tag: Mmwyl1_1926 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: Mmwyl1_1925 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: Mmwyl1_1924 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: Mmwyl1_1923 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: Mmwyl1_1922 Name: add Funciton: Adenosine deaminase (EC 3.5.4.4)
ppuA-ppuC-ppuD-ppuB-add	-185	4.5	TATTAACTAGTCGGTCAGAT	Mmwyl1_1926
Reinekea sp. MED297
Position: -2 Score: 4.30815 Sequence: TCATGACTGCTCAGACAGAT Locus tag: MED297_21307 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: MED297_21302 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: MED297_21297 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
ppuA-ppuC-ppuD	-2	4.3	TCATGACTGCTCAGACAGAT	MED297_21307