Orthologous regulated operons containing OG2516_07987 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Roseobacter sp. MED193 | ||||
Position: -154
Score: 4.74924 Sequence: TTCGCACCAAACGGTCAAAA
Locus tag: MED193_10378
Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: MED193_10383
Name: OG2516_07987 Funciton: Conserved hypothetical protein
Locus tag: MED193_10388
Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: MED193_10393
Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: MED193_10398
Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 |
||||
pntD-OG2516_07987-pntA-pntB-pntC | -154 | 4.7 | TTCGCACCAAACGGTCAAAA | MED193_10378 |