Orthologous regulated operons containing pntA gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |
![](logos/3193_large.png)
Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhodobacterales bacterium HTCC2654 | ||||
Position: -186
Score: 4.77753 Sequence: TTTTGAACGTCGGGTCAAAT
Locus tag: RB2654_20923
Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: RB2654_20928
Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: RB2654_20933
Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: RB2654_20938
Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 |
||||
pntD-pntA-pntB-pntC | -186 | 4.8 | TTTTGAACGTCGGGTCAAAT | RB2654_20923 |
Roseobacter sp. MED193 | ||||
Position: -154
Score: 4.74924 Sequence: TTCGCACCAAACGGTCAAAA
Locus tag: MED193_10378
Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: MED193_10383
Name: OG2516_07987 Funciton: Conserved hypothetical protein
Locus tag: MED193_10388
Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: MED193_10393
Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: MED193_10398
Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 |
||||
pntD-OG2516_07987-pntA-pntB-pntC | -154 | 4.7 | TTCGCACCAAACGGTCAAAA | MED193_10378 |
Silicibacter TM1040 | ||||
Position: -122
Score: 5.2166 Sequence: TTTAGACCGGCTGGTCAAAA
Locus tag: TM1040_3094
Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: TM1040_3095
Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: TM1040_3096
Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: TM1040_3097
Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 |
||||
pntD-pntA-pntB-pntC | -122 | 5.2 | TTTAGACCGGCTGGTCAAAA | TM1040_3094 |
Silicibacter pomeroyi DSS-3 | ||||
Position: -142
Score: 5.13023 Sequence: CTCGGACCATTCGGTCAAAA
Locus tag: SPO0379
Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: SPO0378
Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: SPO0377
Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: SPO0376
Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 |
||||
pntD-pntA-pntB-pntC | -142 | 5.1 | CTCGGACCATTCGGTCAAAA | SPO0379 |