Orthologous regulated operons containing amiC gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -36
Score: 5.45752 Sequence: ATTTTACCATATGGTAAGGA
Locus tag: Jann_1306
Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
Locus tag: Jann_1305
Name: pytM Funciton: Predicted pyrimidine ABC transporter, substrate-binding protein
Locus tag: Jann_1304
Name: amiC Funciton: Predicted amidase
Locus tag: Jann_1303
Name: pytN Funciton: Predicted pyrimidine ABC transporter, ATP-binding protein
Locus tag: Jann_1302
Name: pytO Funciton: Predicted pyrimidine ABC transporter, permease protein 1
Locus tag: Jann_1301
Name: pytQ Funciton: Predicted pyrimidine ABC transporter, permease protein 2 |
||||
codA-pytM-amiC-pytN-pytO-pytQ | -36 | 5.5 | ATTTTACCATATGGTAAGGA | Jann_1306 |