Orthologous regulated operons containing Jann_0787 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -65
Score: 5.56797 Sequence: TTTTGACCGTTTGGTCAACC
Locus tag: Jann_0789
Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
Locus tag: Jann_0788
Name: Jann_0788 Funciton: Hypothetical protein
Locus tag: Jann_0787
Name: Jann_0787 Funciton: Hypothetical protein
Locus tag: Jann_0786
Name: ald Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) |
||||
deoC-Jann_0788-Jann_0787-ald | -65 | 5.6 | TTTTGACCGTTTGGTCAACC | Jann_0789 |