Orthologous regulated operons containing OB2597_04350 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Oceanicola batsensis HTCC2597 | ||||
Position: -66
Score: 5.92024 Sequence: AATTTACCATTTGATAAAAA
Locus tag: OB2597_04355
Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Locus tag: OB2597_04350
Name: OB2597_04350 Funciton: Hypothetical protein
Locus tag: OB2597_04345
Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
||||
pydX-OB2597_04350-pydA | -66 | 5.9 | AATTTACCATTTGATAAAAA | OB2597_04355 |