Orthologous regulated operons containing RSP_0188 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhodobacter sphaeroides 2.4.1 | ||||
Position: -74
Score: 5.38228 Sequence: TATTTATCGTTTGGTAAAAA
Locus tag: RSP_0189
Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Locus tag: RSP_0188
Name: RSP_0188 Funciton: DedA family integral membrane protein
Locus tag: RSP_0187
Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
||||
pydX-RSP_0188-pydA | -74 | 5.4 | TATTTATCGTTTGGTAAAAA | RSP_0189 |