Orthologous regulated operons containing Jann_2702 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -57
Score: 5.67797 Sequence: CCTTGACCGTTTGGTCAAAA
Locus tag: Jann_2709
Name: praX Funciton: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
Locus tag: Jann_2708
Name: Jann_2708 Funciton: Hypothetical protein
Locus tag: Jann_2707
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: Jann_2706
Name: Jann_2706 Funciton: hypothetical protein
Locus tag: Jann_2705
Name: pydB Funciton: phenylhydantoinase
Locus tag: Jann_2704
Name: Jann_2704 Funciton: Hypothetical protein
Locus tag: Jann_2703
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: Jann_2702
Name: Jann_2702 Funciton: Predicted N-acetyltransferase
Locus tag: Jann_2701
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: Jann_2700
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: Jann_2699
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
praX-Jann_2708-pydC-Jann_2706-pydB-Jann_2704-pytA-Jann_2702-pytB-pytC-pytD | -57 | 5.7 | CCTTGACCGTTTGGTCAAAA | Jann_2709 |