Orthologous regulated operons containing OG2516_10891 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Oceanicola granulosus HTCC2516 | ||||
Position: -69
Score: 5.61779 Sequence: CTTTAACCGATTGGTCAAAT
Locus tag: OG2516_10901
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: OG2516_10896
Name: OG2516_10896 Funciton: Hypothetical protein
Locus tag: OG2516_10891
Name: null Funciton: N-carbamoyl-L-amino acid amidohydrolase
Locus tag: OG2516_10886
Name: pydB Funciton: phenylhydantoinase
Locus tag: OG2516_10881
Name: RSP_1242 Funciton: Predicted lyase
Locus tag: OG2516_10876
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: OG2516_10871
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: OG2516_10866
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: OG2516_10861
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-OG2516_10896-OG2516_10891-pydB-RSP_1242-pytA-pytB-pytC-pytD | -69 | 5.6 | CTTTAACCGATTGGTCAAAT | OG2516_10901 |