Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing OG2516_10891 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola granulosus HTCC2516
Position: -69
Score: 5.61779
Sequence: CTTTAACCGATTGGTCAAAT
Locus tag: OG2516_10901
Name: pydC
Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: OG2516_10896
Name: OG2516_10896
Funciton: Hypothetical protein
Locus tag: OG2516_10891
Name: null
Funciton: N-carbamoyl-L-amino acid amidohydrolase
Locus tag: OG2516_10886
Name: pydB
Funciton: phenylhydantoinase
Locus tag: OG2516_10881
Name: RSP_1242
Funciton: Predicted lyase
Locus tag: OG2516_10876
Name: pytA
Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: OG2516_10871
Name: pytB
Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: OG2516_10866
Name: pytC
Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: OG2516_10861
Name: pytD
Funciton: Pyrimidine ABC transporter, substrate-binding protein
pydC-OG2516_10896-OG2516_10891-pydB-RSP_1242-pytA-pytB-pytC-pytD -69 5.6 CTTTAACCGATTGGTCAAAT OG2516_10901
© 2009-2020 RegPrecise