Orthologous regulated operons containing SKA53_10669 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Loktanella vestfoldensis SKA53 | ||||
Position: -39
Score: 5.92449 Sequence: TTTTGACCATCTGGTCAAAC
Locus tag: SKA53_10674
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: SKA53_10669
Name: SKA53_10669 Funciton: Hypothetical protein
Locus tag: SKA53_10664
Name: pydB Funciton: phenylhydantoinase
Locus tag: SKA53_10659
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: SKA53_10654
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: SKA53_10649
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: SKA53_10644
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-SKA53_10669-pydB-pytA-pytB-pytC-pytD | -39 | 5.9 | TTTTGACCATCTGGTCAAAC | SKA53_10674 |