Orthologous regulated operons containing MED193_05494 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Roseobacter sp. MED193 | ||||
Position: -119
Score: 6.08052 Sequence: GTTTGACCAGTTGGTCAAAT
Locus tag: MED193_05519
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: MED193_05514
Name: pydB Funciton: phenylhydantoinase
Locus tag: MED193_05509
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: MED193_05504
Name: MED193_05504 Funciton: Hypothetical protein
Locus tag: MED193_05499
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: MED193_05494
Name: MED193_05494 Funciton: Hypothetical protein
Locus tag: MED193_05489
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2 |
||||
pydC-pydB-pytA-MED193_05504-pytB-MED193_05494-pytC | -119 | 6.1 | GTTTGACCAGTTGGTCAAAT | MED193_05519 |