Orthologous regulated operons containing RB2654_14945 gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Silicibacter pomeroyi DSS-3 | ||||
Position: -64
Score: 6.08052 Sequence: GTTTGACCAGTTGGTCAAAT
Locus tag: SPO1781
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: SPO1782
Name: RB2654_14945 Funciton: Hypothetical protein
Locus tag: SPO1783
Name: pydB Funciton: phenylhydantoinase |
||||
pydC-RB2654_14945-pydB | -64 | 6.1 | GTTTGACCAGTTGGTCAAAT | SPO1781 |