Orthologous regulated operons containing pydP gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Paracoccus denitrificans PD1222 | ||||
Position: -225
Score: 5.14572 Sequence: TATTGACTGGTTGATAAAAT
Locus tag: Pden_1113
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: Pden_1112
Name: pydB Funciton: phenylhydantoinase
Locus tag: Pden_1111
Name: pydP Funciton: Pyrimidine permease in reductive pathway |
||||
pydC-pydB-pydP | -225 | 5.1 | TATTGACTGGTTGATAAAAT | Pden_1113 |