Orthologous regulated operons containing pytB gene
Regulog: | RutR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -57
Score: 5.67797 Sequence: CCTTGACCGTTTGGTCAAAA
Locus tag: Jann_2709
Name: praX Funciton: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
Locus tag: Jann_2708
Name: Jann_2708 Funciton: Hypothetical protein
Locus tag: Jann_2707
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: Jann_2706
Name: Jann_2706 Funciton: hypothetical protein
Locus tag: Jann_2705
Name: pydB Funciton: phenylhydantoinase
Locus tag: Jann_2704
Name: Jann_2704 Funciton: Hypothetical protein
Locus tag: Jann_2703
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: Jann_2702
Name: Jann_2702 Funciton: Predicted N-acetyltransferase
Locus tag: Jann_2701
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: Jann_2700
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: Jann_2699
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
praX-Jann_2708-pydC-Jann_2706-pydB-Jann_2704-pytA-Jann_2702-pytB-pytC-pytD | -57 | 5.7 | CCTTGACCGTTTGGTCAAAA | Jann_2709 |
Loktanella vestfoldensis SKA53 | ||||
Position: -39
Score: 5.92449 Sequence: TTTTGACCATCTGGTCAAAC
Locus tag: SKA53_10674
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: SKA53_10669
Name: SKA53_10669 Funciton: Hypothetical protein
Locus tag: SKA53_10664
Name: pydB Funciton: phenylhydantoinase
Locus tag: SKA53_10659
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: SKA53_10654
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: SKA53_10649
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: SKA53_10644
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-SKA53_10669-pydB-pytA-pytB-pytC-pytD | -39 | 5.9 | TTTTGACCATCTGGTCAAAC | SKA53_10674 |
Oceanicola granulosus HTCC2516 | ||||
Position: -69
Score: 5.61779 Sequence: CTTTAACCGATTGGTCAAAT
Locus tag: OG2516_10901
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: OG2516_10896
Name: OG2516_10896 Funciton: Hypothetical protein
Locus tag: OG2516_10891
Name: null Funciton: N-carbamoyl-L-amino acid amidohydrolase
Locus tag: OG2516_10886
Name: pydB Funciton: phenylhydantoinase
Locus tag: OG2516_10881
Name: RSP_1242 Funciton: Predicted lyase
Locus tag: OG2516_10876
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: OG2516_10871
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: OG2516_10866
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: OG2516_10861
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-OG2516_10896-OG2516_10891-pydB-RSP_1242-pytA-pytB-pytC-pytD | -69 | 5.6 | CTTTAACCGATTGGTCAAAT | OG2516_10901 |
Roseobacter sp. MED193 | ||||
Position: -119
Score: 6.08052 Sequence: GTTTGACCAGTTGGTCAAAT
Locus tag: MED193_05519
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: MED193_05514
Name: pydB Funciton: phenylhydantoinase
Locus tag: MED193_05509
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: MED193_05504
Name: MED193_05504 Funciton: Hypothetical protein
Locus tag: MED193_05499
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: MED193_05494
Name: MED193_05494 Funciton: Hypothetical protein
Locus tag: MED193_05489
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2 |
||||
pydC-pydB-pytA-MED193_05504-pytB-MED193_05494-pytC | -119 | 6.1 | GTTTGACCAGTTGGTCAAAT | MED193_05519 |
Roseovarius nubinhibens ISM | ||||
Position: -41
Score: 5.88633 Sequence: ACTTTACCAAATGGTAAAAT
Locus tag: ISM_13620
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: ISM_13615
Name: pydB Funciton: phenylhydantoinase
Locus tag: ISM_13610
Name: RSP_1242 Funciton: Predicted lyase
Locus tag: ISM_13605
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: ISM_13600
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: ISM_13595
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: ISM_13590
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-pydB-RSP_1242-pytA-pytB-pytC-pytD | -41 | 5.9 | ACTTTACCAAATGGTAAAAT | ISM_13620 |
Roseovarius sp. 217 | ||||
Position: -33
Score: 5.74021 Sequence: AGTTTACCAAATGGTAAAAA
Locus tag: ROS217_12311
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: ROS217_12306
Name: pydB Funciton: phenylhydantoinase
Locus tag: ROS217_12301
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: ROS217_12296
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: ROS217_12291
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: ROS217_12286
Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein |
||||
pydC-pydB-pytA-pytB-pytC-pytD | -33 | 5.7 | AGTTTACCAAATGGTAAAAA | ROS217_12311 |
Silicibacter TM1040 | ||||
Position: -153
Score: 6.08052 Sequence: GTTTGACCAGTTGGTCAAAT
Locus tag: TM1040_1498
Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: TM1040_1497
Name: pydB Funciton: phenylhydantoinase
Locus tag: TM1040_1496
Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: TM1040_1495
Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: TM1040_1494
Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2 |
||||
pydC-pydB-pytA-pytB-pytC | -153 | 6.1 | GTTTGACCAGTTGGTCAAAT | TM1040_1498 |