Orthologous regulated operons containing pehX gene
Regulog: | KdgR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | IclR |
Regulation mode: | repressor (activator) |
Biological process: | Pectin and polygalacturonate utlization |
Effector: | 2-keto-3-deoxygluconate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
Position: -291
Score: 4.91898 Sequence: TAATGAAACCATGTTTTACCA
Locus tag: ECA3112
Name: pelF Funciton: Pectate lyase precursor (EC 4.2.2.2)
Locus tag: ECA3111
Name: pehX Funciton: Exo-poly-alpha-D-galacturonosidase precursor (EC 3.2.1.82) |
||||
pelF-pehX | -291 | 4.9 | TAATGAAACCATGTTTTACCA | ECA3112 |