Orthologous regulated operons containing spiX gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -54
Score: 5.11535 Sequence: AATTGAAATACAGTTTTAAAA
Locus tag: ECA1742
Name: spiX Funciton: predicted 5-keto-4-deoxyuronate isomerase |
||||
| spiX | -54 | 5.1 | AATTGAAATACAGTTTTAAAA | ECA1742 |