Orthologous regulated operons containing paeY gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -213
Score: 5.12866 Sequence: TATTAAAATAACATTTCACTT
Locus tag: ECA3252
Name: paeY Funciton: pectin acetylesterase
Locus tag: ECA3253
Name: pemA Funciton: Putative pectinesterase (EC 3.1.1.11) |
||||
| paeY-pemA | -213 | 5.1 | TATTAAAATAACATTTCACTT | ECA3252 |