Orthologous regulated operons containing pehN gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -37
Score: 5.69647 Sequence: TATTAAAACGATATTTCATTA
Locus tag: ECA1190
Name: pehN Funciton: putative polygalacturonase |
||||
| pehN | -37 | 5.7 | TATTAAAACGATATTTCATTA | ECA1190 |