Orthologous regulated operons containing yjcB gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -121
Score: 5.11052 Sequence: AACAGAAACGTTGTTTCATTC
Locus tag: CKO_03830
Name: yjcB Funciton: putative inner membrane protein |
||||
| yjcB | -121 | 5.1 | AACAGAAACGTTGTTTCATTC | CKO_03830 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -113
Score: 4.94925 Sequence: AACAGAAATGGCGTTTCATCA
Locus tag: KPN_04460
Name: yjcB Funciton: putative inner membrane protein |
||||
| yjcB | -113 | 4.9 | AACAGAAATGGCGTTTCATCA | KPN_04460 |
| Salmonella typhimurium LT2 | ||||
|
Position: -120
Score: 5.38426 Sequence: AATAGAAACAATGTTTCATTC
Locus tag: STM4263
Name: yjcB Funciton: putative inner membrane protein |
||||
| yjcB | -120 | 5.4 | AATAGAAACAATGTTTCATTC | STM4263 |