Orthologous regulated operons containing rhiC gene

Properties
Regulog:	KdgR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 159 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Enterobacter sp. 638
Position: -134 Score: 4.5088 Sequence: TTTCAAACCATCGTTTCAAAA Position: -49 Score: 4.79435 Sequence: AACTAAAACAACGTTTTAACG Locus tag: Ent638_3876 Name: rhiA Funciton: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit Locus tag: Ent638_3875 Name: rhiB Funciton: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit Locus tag: Ent638_3874 Name: rhiC Funciton: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
rhiA-rhiB-rhiC	-134	4.5	TTTCAAACCATCGTTTCAAAA	Ent638_3876
	-49	4.8	AACTAAAACAACGTTTTAACG
Salmonella typhimurium LT2
Position: -126 Score: 4.71378 Sequence: ATGTGAAACAGGGTTTCAAAA Locus tag: STM4054 Name: rhiA Funciton: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit Locus tag: STM4053 Name: rhiB Funciton: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit Locus tag: STM4052 Name: rhiC Funciton: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
rhiA-rhiB-rhiC	-126	4.7	ATGTGAAACAGGGTTTCAAAA	STM4054

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --