Orthologous regulated operons containing rhiC gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -134
Score: 4.5088 Sequence: TTTCAAACCATCGTTTCAAAA
Position: -49
Score: 4.79435 Sequence: AACTAAAACAACGTTTTAACG
Locus tag: Ent638_3876
Name: rhiA Funciton: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
Locus tag: Ent638_3875
Name: rhiB Funciton: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
Locus tag: Ent638_3874
Name: rhiC Funciton: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit |
||||
| rhiA-rhiB-rhiC | -134 | 4.5 | TTTCAAACCATCGTTTCAAAA | Ent638_3876 |
| -49 | 4.8 | AACTAAAACAACGTTTTAACG | ||
| Salmonella typhimurium LT2 | ||||
|
Position: -126
Score: 4.71378 Sequence: ATGTGAAACAGGGTTTCAAAA
Locus tag: STM4054
Name: rhiA Funciton: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
Locus tag: STM4053
Name: rhiB Funciton: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
Locus tag: STM4052
Name: rhiC Funciton: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit |
||||
| rhiA-rhiB-rhiC | -126 | 4.7 | ATGTGAAACAGGGTTTCAAAA | STM4054 |