Orthologous regulated operons containing ygjV gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -70
Score: 6.16722 Sequence: AAATAAAACGGCGTTTCATTT
Locus tag: ECA0648
Name: ygjV Funciton: putative transport protein |
||||
| ygjV | -70 | 6.2 | AAATAAAACGGCGTTTCATTT | ECA0648 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -64
Score: 5.35657 Sequence: ATAAAAAACGGCGTTTCATAA
Locus tag: b3090
Name: ygjV Funciton: putative transport protein |
||||
| ygjV | -64 | 5.4 | ATAAAAAACGGCGTTTCATAA | b3090 |
| Yersinia pestis KIM | ||||
|
Position: -133
Score: 5.17562 Sequence: ATATGAAACGGTGTTCTGTTT
Locus tag: y3597
Name: ygjV Funciton: putative transport protein |
||||
| ygjV | -133 | 5.2 | ATATGAAACGGTGTTCTGTTT | y3597 |