Orthologous regulated operons containing rhiN gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -190
Score: 5.41818 Sequence: AATAGAAACGCTGTTTTATAA
Locus tag: CKO_01081
Name: rhiT Funciton: Rhamnogalacturonide transporter
Locus tag: CKO_01082
Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
||||
| rhiT-rhiN | -190 | 5.4 | AATAGAAACGCTGTTTTATAA | CKO_01081 |
| Enterobacter sp. 638 | ||||
|
Position: -189
Score: 5.60112 Sequence: AAAAGAAACGCTGTTTTATAA
Locus tag: Ent638_2444
Name: rhiT Funciton: Rhamnogalacturonide transporter
Locus tag: Ent638_2443
Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
||||
| rhiT-rhiN | -189 | 5.6 | AAAAGAAACGCTGTTTTATAA | Ent638_2444 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -167
Score: 4.66061 Sequence: AGTTAAAATGCCTTTTTATAA
Locus tag: ECA3560
Name: rhiT Funciton: Rhamnogalacturonide transporter
Locus tag: ECA3559
Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
||||
| rhiT-rhiN | -167 | 4.7 | AGTTAAAATGCCTTTTTATAA | ECA3560 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -200
Score: 4.94227 Sequence: AAGAGAAATGCTGTTTTATAA
Locus tag: KPN_02390
Name: rhiT Funciton: Rhamnogalacturonide transporter
Locus tag: KPN_02389
Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
||||
| rhiT-rhiN | -200 | 4.9 | AAGAGAAATGCTGTTTTATAA | KPN_02390 |