Orthologous regulated operons containing ogl gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -226
Score: 5.12819 Sequence: AATTAAAACGCCGTTTTACAA
Locus tag: Ent638_3289
Name: togM Funciton: oligogalacturonide ABC transporter, inner membrane permease
Locus tag: Ent638_3290
Name: togN Funciton: oligogalacturonide ABC transporter, inner membrane permease
Locus tag: Ent638_3291
Name: togA Funciton: oligogalacturonide ABC transporter, ATP-binding component
Locus tag: Ent638_3292
Name: togB Funciton: oligogalacturonide ABC transporter, solute-binding periplasmic protein
Locus tag: Ent638_3293
Name: ogl Funciton: Oligogalacturonate lyase (EC 4.2.2.6) |
||||
| togM-togN-togA-togB-ogl | -226 | 5.1 | AATTAAAACGCCGTTTTACAA | Ent638_3289 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -180
Score: 5.75768 Sequence: AAATGAAACATTGTTTCTATA
Locus tag: ECA2426
Name: ogl Funciton: Oligogalacturonate lyase (EC 4.2.2.6) |
||||
| ogl | -180 | 5.8 | AAATGAAACATTGTTTCTATA | ECA2426 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -299
Score: 5.83027 Sequence: ATTTAAAACGATGTTTCATTT
Position: -103
Score: 5.62695 Sequence: TAATGAAACAATGTTTTGATA
Locus tag: KPN_03266
Name: ogl Funciton: Oligogalacturonate lyase (EC 4.2.2.6) |
||||
| ogl | -299 | 5.8 | ATTTAAAACGATGTTTCATTT | KPN_03266 |
| -103 | 5.6 | TAATGAAACAATGTTTTGATA | ||
| Yersinia pestis KIM | ||||
|
Position: -96
Score: 5.75768 Sequence: AAATGAAACATTGTTTCTATA
Locus tag: y1875
Name: ogl Funciton: Oligogalacturonate lyase (EC 4.2.2.6) |
||||
| ogl | -96 | 5.8 | AAATGAAACATTGTTTCTATA | y1875 |