Orthologous regulated operons containing kdgF gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -38
Score: 5.55738 Sequence: AGTTGAAACATTGTTTCAATA
Locus tag: CKO_04218
Name: kdgF Funciton: Pectin degradation protein KdgF |
||||
| kdgF | -38 | 5.6 | AGTTGAAACATTGTTTCAATA | CKO_04218 |
| Enterobacter sp. 638 | ||||
|
Position: -38
Score: 5.49445 Sequence: AATTAAAACAATGTTTCACTA
Locus tag: Ent638_3287
Name: kdgF Funciton: Pectin degradation protein KdgF |
||||
| kdgF | -38 | 5.5 | AATTAAAACAATGTTTCACTA | Ent638_3287 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -174
Score: 6.08823 Sequence: AAATGAAATAATGTTTTATTT
Locus tag: ECA2399
Name: kdgF Funciton: Pectin degradation protein KdgF |
||||
| kdgF | -174 | 6.1 | AAATGAAATAATGTTTTATTT | ECA2399 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -39
Score: 5.82635 Sequence: AAATGAAACAATGTTTCACTT
Locus tag: KPN_03255
Name: kdgF Funciton: Pectin degradation protein KdgF |
||||
| kdgF | -39 | 5.8 | AAATGAAACAATGTTTCACTT | KPN_03255 |
| Yersinia pestis KIM | ||||
|
Position: -155
Score: 5.97045 Sequence: AAATGAAATGATGTTTTATTA
Locus tag: y1888
Name: kdgF Funciton: Pectin degradation protein KdgF |
||||
| kdgF | -155 | 6 | AAATGAAATGATGTTTTATTA | y1888 |