Orthologous regulated operons containing ppsR gene
| Regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -107
Score: 5.46645 Sequence: TATAAAAATAGCGTTTCATTT
Locus tag: CKO_01727
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -107 | 5.5 | TATAAAAATAGCGTTTCATTT | CKO_01727 |
| Enterobacter sp. 638 | ||||
|
Position: -107
Score: 5.33969 Sequence: ATTAAAAACACCATTTCATTT
Locus tag: Ent638_1744
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -107 | 5.3 | ATTAAAAACACCATTTCATTT | Ent638_1744 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -94
Score: 5.63269 Sequence: TAATGAAATGGCGTTTTAATA
Locus tag: ECA1852
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -94 | 5.6 | TAATGAAATGGCGTTTTAATA | ECA1852 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -131
Score: 5.25789 Sequence: AAATGAAATGCTGTTTTCATA
Locus tag: b1703
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -131 | 5.3 | AAATGAAATGCTGTTTTCATA | b1703 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -97
Score: 5.12755 Sequence: AACAAAAATAGCGTTTCAATT
Locus tag: KPN_02161
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -97 | 5.1 | AACAAAAATAGCGTTTCAATT | KPN_02161 |
| Salmonella typhimurium LT2 | ||||
|
Position: -131
Score: 4.85744 Sequence: AAATGAAACACACTTTTCATT
Locus tag: STM1348
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -131 | 4.9 | AAATGAAACACACTTTTCATT | STM1348 |
| Serratia proteamaculans 568 | ||||
|
Position: -134
Score: 5.16114 Sequence: ATTTGAAATAGTGTTTTACTT
Locus tag: Spro_2173
Name: ppsR Funciton: PEP synthetase regulatory protein |
||||
| ppsR | -134 | 5.2 | ATTTGAAATAGTGTTTTACTT | Spro_2173 |