Orthologous regulated operons containing hpt gene
| Regulog: | RutR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -46
Score: 5.0907 Sequence: TTTTTACTGAAAGGTAAAAT
Locus tag: Atu3604
Name: hpt Funciton: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
||||
| hpt | -46 | 5.1 | TTTTTACTGAAAGGTAAAAT | Atu3604 |