Orthologous regulated operons containing DvMF_2925 gene
| Regulog: | DvMF_2930 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -54
Score: 5.57132 Sequence: TCGGGCATTGACGATGCAACG
Locus tag: DvMF_2925
Name: null Funciton: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
||||
| DvMF_2925 | -54 | 5.6 | TCGGGCATTGACGATGCAACG | DvMF_2925 |