Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing DMR_28430 gene

Properties
Regulog: DVU0057 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris str. Miyazaki F
Position: -70
Score: 6.96413
Sequence: GGTTCAAACAATGATTGAATT
Locus tag: DvMF_2165
Name: null
Funciton: Transcriptional regulator, TetR family
Locus tag: DvMF_2164
Name: acrA
Funciton: efflux transporter, RND family, MFP subunit
Locus tag: DvMF_2163
Name: acrB
Funciton: RND efflux system, inner membrane transporter CmeB
Locus tag: DvMF_2162
Name: oprM
Funciton: RND efflux system, outer membrane lipoprotein, NodT family
Locus tag: DvMF_2161
Name: null
Funciton: Transcriptional regulator, MarR family
DvMF_2165-acrA-acrB-oprM-DvMF_2161 -70 7 GGTTCAAACAATGATTGAATT DvMF_2165