Orthologous regulated operons containing etfD gene
| Regulog: | PsrA - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -122
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: PA2953
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -122 | 5.9 | ATTCAAACAAACGTTTGTAT | PA2953 |
| Pseudomonas entomophila L48 | ||||
|
Position: -153
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: PSEEN3660
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -153 | 5.9 | ATTCAAACAAACGTTTGTAT | PSEEN3660 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -176
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: PFL_1818
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -176 | 5.9 | ATTCAAACAAACGTTTGTAT | PFL_1818 |
| Pseudomonas mendocina ymp | ||||
|
Position: -123
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: Pmen_2708
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -123 | 5.9 | ATTCAAACAAACGTTTGTAT | Pmen_2708 |
| Pseudomonas putida KT2440 | ||||
|
Position: -163
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: PP4203
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -163 | 5.9 | ATTCAAACAAACGTTTGTAT | PP4203 |
| Pseudomonas stutzeri A1501 | ||||
|
Position: -130
Score: 5.90565 Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: PST_2607
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -130 | 5.9 | ATTCAAACAAACGTTTGTAT | PST_2607 |