Orthologous regulated operons containing psrA gene
Regulog: | PsrA - Pseudomonadaceae |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Fatty acid degradation |
Effector: | Oleate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudomonas aeruginosa PAO1 | ||||
Position: -45
Score: 4.95268 Sequence: GCTGAAACGTATGTTTCAAA
Position: -32
Score: 5.76096 Sequence: TTTCAAACAAGTGTTTGTCA
Locus tag: PA3006
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -45 | 5 | GCTGAAACGTATGTTTCAAA | PA3006 |
-32 | 5.8 | TTTCAAACAAGTGTTTGTCA | ||
Pseudomonas entomophila L48 | ||||
Position: -45
Score: 4.74262 Sequence: CCTGAAACGTATGTTTCAAA
Position: -32
Score: 5.71344 Sequence: TTTCAAACAACTGTTTGTCA
Locus tag: PSEEN3720
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -45 | 4.7 | CCTGAAACGTATGTTTCAAA | PSEEN3720 |
-32 | 5.7 | TTTCAAACAACTGTTTGTCA | ||
Pseudomonas fluorescens Pf-5 | ||||
Position: -45
Score: 4.74262 Sequence: CCTGAAACGTATGTTTCAAA
Position: -32
Score: 5.76096 Sequence: TTTCAAACAAGTGTTTGTCA
Locus tag: PFL_1950
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -45 | 4.7 | CCTGAAACGTATGTTTCAAA | PFL_1950 |
-32 | 5.8 | TTTCAAACAAGTGTTTGTCA | ||
Pseudomonas mendocina ymp | ||||
Position: -44
Score: 4.95268 Sequence: GCTGAAACGTATGTTTCAAA
Position: -31
Score: 5.76096 Sequence: TTTCAAACAAGTGTTTGTCA
Locus tag: Pmen_1588
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -44 | 5 | GCTGAAACGTATGTTTCAAA | Pmen_1588 |
-31 | 5.8 | TTTCAAACAAGTGTTTGTCA | ||
Pseudomonas putida KT2440 | ||||
Position: -54
Score: 4.95268 Sequence: GCTGAAACGTATGTTTCAAA
Position: -41
Score: 5.67532 Sequence: TTTCAAACACCTGTTTGTCT
Locus tag: PP2144
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -54 | 5 | GCTGAAACGTATGTTTCAAA | PP2144 |
-41 | 5.7 | TTTCAAACACCTGTTTGTCT | ||
Pseudomonas stutzeri A1501 | ||||
Position: -32
Score: 5.63491 Sequence: TTTCAAACAGTTGTTTGTCT
Locus tag: PST_1735
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -32 | 5.6 | TTTCAAACAGTTGTTTGTCT | PST_1735 |
Pseudomonas syringae pv. tomato str. DC3000 | ||||
Position: -31
Score: 5.63936 Sequence: TTTCAAACGTTCGTTTGTTA
Locus tag: PSPTO3508
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
psrA | -31 | 5.6 | TTTCAAACGTTCGTTTGTTA | PSPTO3508 |